Using hgvs¶
This notebook demonstrates major features of the hgvs package.
'0.5.0a6.dev3+nf998c16a46b3.d20161012'
Variant I/O¶
Initialize the parser¶
Parse a simple variant¶
SequenceVariant(ac=NC_000007.13, type=g, posedit=21726874G>A)
('NC_000007.13', 'g')
PosEdit(pos=21726874, edit=G>A, uncertain=False)
Interval(start=21726874, end=21726874, uncertain=False)
SimplePosition(base=21726874, uncertain=False)
Parsing complex variants¶
(BaseOffsetPosition(base=13552, offset=0, datum=1, uncertain=False),
BaseOffsetPosition(base=36, offset=0, datum=2, uncertain=False))
NARefAlt(ref=57, alt=None, uncertain=False)
Formatting variants¶
All objects may be formatted simply by “stringifying” or printing them
using str, print(), or "".format().
'NM_003777.3:c.13552_*36del57'
NM_003777.3:c.13552_*36del57
'NM_003777.3:c.13552_*36del57 spans the CDS end'
Projecting variants between sequences¶
Set up a dataprovider¶
Mapping variants requires exon structures, alignments, CDS bounds, and
raw sequence. These are provided by a hgvs.dataprovider instance.
The only dataprovider provided with hgvs uses UTA. You may write your
own by subsclassing hgvs.dataproviders.interface.
Initialize mapper classes¶
The VariantMapper class projects variants between two sequence accessions using alignments from a specified source. In order to use it, you must know that two sequences are aligned. VariantMapper isn’t demonstrated here.
AssemblyMapper builds on VariantMapper and handles identifying appropriate sequences. It is configured for a particular genome assembly.
c_to_g¶
This is the easiest case because there is typically only one alignment between a transcript and the genome. (Exceptions exist for pseudoautosomal regions.)
g_to_c¶
In order to project a genomic variant onto a transcript, you must tell the AssemblyMapper which transcript to use.
['NM_015120.4']
SequenceVariant(ac=NM_015120.4, type=c, posedit=35T>C)
Projecting in the presence of a genome-transcript gap¶
As of Oct 2016, 1033 RefSeq transcripts in 433 genes have gapped alignments. These gaps require special handlingin order to maintain the correspondence of positions in an alignment. hgvs uses the precomputed alignments in UTA to correctly project variants in exons containing gapped alignments.
This example demonstrates projecting variants in the presence of a gap in the alignment of NM_015120.4 (ALMS1) with GRCh37 chromosome 2. (The alignment with GRCh38 is similarly gapped.) Specifically, the adjacent genomic positions 73613031 and 73613032 correspond to the non-adjacent CDS positions 35 and 39.
NM_015120.4 c 15 > > 58
NM_015120.4 n 126 > CCGGGCGAGCTGGAGGAGGAGGAG > 169
||||||||||| |||||||||| 21=3I20=
NC_000002.11 g 73613021 > CCGGGCGAGCT---GGAGGAGGAG > 73613041
NC_000002.11 g 73613021 < GGCCCGCTCGA---CCTCCTCCTC < 73613041
'NC_000002.11:g.73613031T>C'
'NC_000002.11:g.73613032G>C'
Normalizing variants¶
In hgvs, normalization means shifting variants 3’ (as requried by the HGVS nomenclature) as well as rewriting variants. The variant “NM_001166478.1:c.30_31insT” is in a poly-T run (on the transcript). It should be shifted 3’ and is better written as dup, as shown below:
* NC_000006.11:g.49917127dupA
NC_000006.11 g 49917117 > AGAAAGAAAAATAAAACAAAG > 49917137
NC_000006.11 g 49917117 < TCTTTCTTTTTATTTTGTTTC < 49917137
||||||||||||||||||||| 21=
NM_001166478.1 n 41 < TCTTTCTTTTTATTTTGTTTC < 21 NM_001166478.1:n.35dupT
NM_001166478.1 c 41 < < 21 NM_001166478.1:c.30_31insT
'NM_001166478.1:c.35dupT'
A more complex normalization example¶
This example is based on https://github.com/biocommons/hgvs/issues/382/.
NC_000001.11 g 27552104 > CTTCACACGCATCCTGACCTTG > 27552125
NC_000001.11 g 27552104 < GAAGTGTGCGTAGGACTGGAAC < 27552125
|||||||||||||||||||||| 22=
NM_001029882.3 n 843 < GAAGTGTGCGTAGGACTGGAAC < 822
NM_001029882.3 c 12 < < -10
^^
NM_001029882.3:c.1_2del
NM_001029882.3:n.832_833delAT
NC_000001.11:g.27552114_27552115delAT
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552115T>C)
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552114A>C)
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552114_27552115delAT)
The genomic coordinates for the SNVs at c.1 and c.2 match those for the del at c.1_2. Good!
Now, notice what happens with c.1_3del, c.1_4del, and c.1_5del:
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552114_27552116delATC)
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552112_27552115delGCAT)
SequenceVariant(ac=NC_000001.11, type=g, posedit=27552112_27552116delGCATC)
Explanation:
On the transcript, c.1_2delAT deletes AT from …AGGATGCG…, resulting in …AGGGCG…. There’s no ambiguity about what sequence was actually deleted.
c.1_3delATG deletes ATG, resulting in …AGGCG…. Note that you could also get this result by deleting GAT. This is an example of an indel that is subject to normalization and hgvs does this.
c.1_4delATGC and 1_5delATGCG have similar behaviors.
Normalization is always 3’ with respect to the reference sequence. So, after projecting from a - strand transcript to the genome, normalization will go in the opposite direction to the transcript. It will have roughly the same effect as being 5’ shifted on the transcript (but revcomp’d).
For more precise control, see the normalize and
replace_reference options of AssemblyMapper.
Validating variants¶
hgvs.validator.Validator is a composite of two classes,
hgvs.validator.IntrinsicValidator and
hgvs.validator.ExtrinsicValidator. Intrinsic validation evaluates a
given variant for internal consistency, such as requiring that
insertions specify adjacent positions. Extrinsic validation evaluates a
variant using external data, such as ensuring that the reference
nucleotide in the variant matches that implied by the reference sequence
and position. Validation returns True if successful, and raises an
exception otherwise.
True
insertion length must be 1